Review



human foxp3 gene  (EpigenDx)


Bioz Verified Symbol EpigenDx is a verified supplier
Bioz Manufacturer Symbol EpigenDx manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    EpigenDx human foxp3 gene
    Human Foxp3 Gene, supplied by EpigenDx, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/Human+FOXP3+Gene+Methylation+Pyrosequencing+Assays/us12060566-615-8-14
    Average 93 stars, based on 6 article reviews
    human foxp3 gene - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    other:

    Article Title: Self-inactivating lentiviral vector comprising a FOXP3 expression cassette
    Article Snippet: Samples were acquired on a LSRII or LSR-Fortessa flow cytometer (BD Biosciences).

    Methylation:

    Article Title: Lentiviral Gene Therapy in HSCs Restores Lineage-Specific Foxp3 Expression and Suppresses Autoimmunity in a Mouse Model of IPEX Syndrome.
    Article Snippet: Genomic DNAwas extracted from sorted Treg (CD4+CD25+) and Tconv (CD4+CD25-) subsets using the Purelink Genomic DNAmini kit (Invitrogen). .. CpG dinucleotide methylation analysis of CNS2 of the human FoxP3 gene was performed by EpigenDx and determined by bisulfite treatment of RNase-treated genomic DNA, followed by PCR amplification and pyrosequencing (EpigenDx assay ADS783-FS2). .. A custom assay was performed by EpigenDx for methylation analysis of FoxP3 CNS2 from integrated LV DNA using the following primers which uniquely recognize viral CNS2: FoxP3 CNS2 Viral F: TGGAGTTAGATTGTTTGGGA; FoxP3 CNS2 Viral R: CACCTATAAATCCAAATACCCCAC.

    Polymerase Chain Reaction:

    Article Title: Lentiviral Gene Therapy in HSCs Restores Lineage-Specific Foxp3 Expression and Suppresses Autoimmunity in a Mouse Model of IPEX Syndrome.
    Article Snippet: Genomic DNAwas extracted from sorted Treg (CD4+CD25+) and Tconv (CD4+CD25-) subsets using the Purelink Genomic DNAmini kit (Invitrogen). .. CpG dinucleotide methylation analysis of CNS2 of the human FoxP3 gene was performed by EpigenDx and determined by bisulfite treatment of RNase-treated genomic DNA, followed by PCR amplification and pyrosequencing (EpigenDx assay ADS783-FS2). .. A custom assay was performed by EpigenDx for methylation analysis of FoxP3 CNS2 from integrated LV DNA using the following primers which uniquely recognize viral CNS2: FoxP3 CNS2 Viral F: TGGAGTTAGATTGTTTGGGA; FoxP3 CNS2 Viral R: CACCTATAAATCCAAATACCCCAC.

    Amplification:

    Article Title: Lentiviral Gene Therapy in HSCs Restores Lineage-Specific Foxp3 Expression and Suppresses Autoimmunity in a Mouse Model of IPEX Syndrome.
    Article Snippet: Genomic DNAwas extracted from sorted Treg (CD4+CD25+) and Tconv (CD4+CD25-) subsets using the Purelink Genomic DNAmini kit (Invitrogen). .. CpG dinucleotide methylation analysis of CNS2 of the human FoxP3 gene was performed by EpigenDx and determined by bisulfite treatment of RNase-treated genomic DNA, followed by PCR amplification and pyrosequencing (EpigenDx assay ADS783-FS2). .. A custom assay was performed by EpigenDx for methylation analysis of FoxP3 CNS2 from integrated LV DNA using the following primers which uniquely recognize viral CNS2: FoxP3 CNS2 Viral F: TGGAGTTAGATTGTTTGGGA; FoxP3 CNS2 Viral R: CACCTATAAATCCAAATACCCCAC.



    Similar Products

    90
    Sino Biological plasmid pcmv3 n ha foxp3
    A. <t>Foxp3</t> expression is examined with western blotting assay in three T24 bladder cancer sublines (T24-P, T24-L, and T24-B). B. Assays for glucose, lactate, and ATP production in three T24 sublines. C. VEGF mRNA and D. GLUT-1~5 mRNA expression is examined in three T24 sublines using qRT-PCR assay. E. Foxp3 mRNA expression is examined in Foxp3-knocking down T24-B transfectants and its control. F. Assays for glucose and lactate production, G. VEGF mRNA expression, and H. GLUT-1~5 as assayed in Foxp3-knocking down transfectant #25 and its control. I. Foxp3 expression is examined with western blotting assay after transient transfection of Foxp3 plasmid into T24-P bladder cancer cells. J. Assays for glucose and lactate production, K. VEGF mRNA expression, and L. GLUT-1~5 as assayed in pooled Foxp3-overexpressing T24-P transfectants and its control. T24-P, T24 parental subline; T24-L, metastatic lung T24 subline; T24-B, metastatic bone T24 subline; ATP, Adenosine triphosphate; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; VEGF, vascular endothelial growth factor; NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.
    Plasmid Pcmv3 N Ha Foxp3, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/Human+FOXP3+Gene+ORF+cDNA+clone+expression+plasmid%2C+N-HA+tag/pmc05323164-183-1-6
    Average 90 stars, based on 1 article reviews
    plasmid pcmv3 n ha foxp3 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    TaKaRa human cd4 t cells human foxp3 gene
    A. <t>Foxp3</t> expression is examined with western blotting assay in three T24 bladder cancer sublines (T24-P, T24-L, and T24-B). B. Assays for glucose, lactate, and ATP production in three T24 sublines. C. VEGF mRNA and D. GLUT-1~5 mRNA expression is examined in three T24 sublines using qRT-PCR assay. E. Foxp3 mRNA expression is examined in Foxp3-knocking down T24-B transfectants and its control. F. Assays for glucose and lactate production, G. VEGF mRNA expression, and H. GLUT-1~5 as assayed in Foxp3-knocking down transfectant #25 and its control. I. Foxp3 expression is examined with western blotting assay after transient transfection of Foxp3 plasmid into T24-P bladder cancer cells. J. Assays for glucose and lactate production, K. VEGF mRNA expression, and L. GLUT-1~5 as assayed in pooled Foxp3-overexpressing T24-P transfectants and its control. T24-P, T24 parental subline; T24-L, metastatic lung T24 subline; T24-B, metastatic bone T24 subline; ATP, Adenosine triphosphate; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; VEGF, vascular endothelial growth factor; NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.
    Human Cd4 T Cells Human Foxp3 Gene, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/pmc08671535__41467_2021_27574_MOESM1_ESM-51-77-89
    Average 86 stars, based on 1 article reviews
    human cd4 t cells human foxp3 gene - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    93
    EpigenDx human foxp3 gene
    A. <t>Foxp3</t> expression is examined with western blotting assay in three T24 bladder cancer sublines (T24-P, T24-L, and T24-B). B. Assays for glucose, lactate, and ATP production in three T24 sublines. C. VEGF mRNA and D. GLUT-1~5 mRNA expression is examined in three T24 sublines using qRT-PCR assay. E. Foxp3 mRNA expression is examined in Foxp3-knocking down T24-B transfectants and its control. F. Assays for glucose and lactate production, G. VEGF mRNA expression, and H. GLUT-1~5 as assayed in Foxp3-knocking down transfectant #25 and its control. I. Foxp3 expression is examined with western blotting assay after transient transfection of Foxp3 plasmid into T24-P bladder cancer cells. J. Assays for glucose and lactate production, K. VEGF mRNA expression, and L. GLUT-1~5 as assayed in pooled Foxp3-overexpressing T24-P transfectants and its control. T24-P, T24 parental subline; T24-L, metastatic lung T24 subline; T24-B, metastatic bone T24 subline; ATP, Adenosine triphosphate; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; VEGF, vascular endothelial growth factor; NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.
    Human Foxp3 Gene, supplied by EpigenDx, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/Human+FOXP3+Gene+Methylation+Pyrosequencing+Assays/us12060566-615-8-14
    Average 93 stars, based on 1 article reviews
    human foxp3 gene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    EpigenDx cpg region human foxp3 gene methylation pyrosequencing assay
    A. <t>Foxp3</t> expression is examined with western blotting assay in three T24 bladder cancer sublines (T24-P, T24-L, and T24-B). B. Assays for glucose, lactate, and ATP production in three T24 sublines. C. VEGF mRNA and D. GLUT-1~5 mRNA expression is examined in three T24 sublines using qRT-PCR assay. E. Foxp3 mRNA expression is examined in Foxp3-knocking down T24-B transfectants and its control. F. Assays for glucose and lactate production, G. VEGF mRNA expression, and H. GLUT-1~5 as assayed in Foxp3-knocking down transfectant #25 and its control. I. Foxp3 expression is examined with western blotting assay after transient transfection of Foxp3 plasmid into T24-P bladder cancer cells. J. Assays for glucose and lactate production, K. VEGF mRNA expression, and L. GLUT-1~5 as assayed in pooled Foxp3-overexpressing T24-P transfectants and its control. T24-P, T24 parental subline; T24-L, metastatic lung T24 subline; T24-B, metastatic bone T24 subline; ATP, Adenosine triphosphate; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; VEGF, vascular endothelial growth factor; NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.
    Cpg Region Human Foxp3 Gene Methylation Pyrosequencing Assay, supplied by EpigenDx, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/Human+FOXP3+TSDR+Methylation+Assay/pm38494386-63-11-19
    Average 93 stars, based on 1 article reviews
    cpg region human foxp3 gene methylation pyrosequencing assay - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Lonza human foxp3 target genes
    A. <t>Foxp3</t> expression is examined with western blotting assay in three T24 bladder cancer sublines (T24-P, T24-L, and T24-B). B. Assays for glucose, lactate, and ATP production in three T24 sublines. C. VEGF mRNA and D. GLUT-1~5 mRNA expression is examined in three T24 sublines using qRT-PCR assay. E. Foxp3 mRNA expression is examined in Foxp3-knocking down T24-B transfectants and its control. F. Assays for glucose and lactate production, G. VEGF mRNA expression, and H. GLUT-1~5 as assayed in Foxp3-knocking down transfectant #25 and its control. I. Foxp3 expression is examined with western blotting assay after transient transfection of Foxp3 plasmid into T24-P bladder cancer cells. J. Assays for glucose and lactate production, K. VEGF mRNA expression, and L. GLUT-1~5 as assayed in pooled Foxp3-overexpressing T24-P transfectants and its control. T24-P, T24 parental subline; T24-L, metastatic lung T24 subline; T24-B, metastatic bone T24 subline; ATP, Adenosine triphosphate; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; VEGF, vascular endothelial growth factor; NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.
    Human Foxp3 Target Genes, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/human+foxp3+target+genes/pm37246921-33-17-21
    Average 90 stars, based on 1 article reviews
    human foxp3 target genes - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    EpigenDx foxp3 dna methylation
    A. <t>Foxp3</t> expression is examined with western blotting assay in three T24 bladder cancer sublines (T24-P, T24-L, and T24-B). B. Assays for glucose, lactate, and ATP production in three T24 sublines. C. VEGF mRNA and D. GLUT-1~5 mRNA expression is examined in three T24 sublines using qRT-PCR assay. E. Foxp3 mRNA expression is examined in Foxp3-knocking down T24-B transfectants and its control. F. Assays for glucose and lactate production, G. VEGF mRNA expression, and H. GLUT-1~5 as assayed in Foxp3-knocking down transfectant #25 and its control. I. Foxp3 expression is examined with western blotting assay after transient transfection of Foxp3 plasmid into T24-P bladder cancer cells. J. Assays for glucose and lactate production, K. VEGF mRNA expression, and L. GLUT-1~5 as assayed in pooled Foxp3-overexpressing T24-P transfectants and its control. T24-P, T24 parental subline; T24-L, metastatic lung T24 subline; T24-B, metastatic bone T24 subline; ATP, Adenosine triphosphate; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; VEGF, vascular endothelial growth factor; NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.
    Foxp3 Dna Methylation, supplied by EpigenDx, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/pm36045140-379-4-13
    Average 93 stars, based on 1 article reviews
    foxp3 dna methylation - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    EpigenDx foxp3 gene
    Most Treg signature genes gradually demethylate over a three year time course after in vivo BCG vaccinations. Methylation changes in eleven well-known Treg signature genes were quantified yearly after multi-dose BCG vaccine therapy (n = 13 type 1 diabetic subjects). ( a ) The methylation values are current methylation values at year 1, year 2 or year 3 compared to baseline expressed as average change in beta values. Positive beta values indicate increased methylation and thus decreased gene expression; negative methylation values indicate demethylation and increased gene expression. Significant decreases in methylation after BCG were seen in eight of 11 genes: <t>FOXP3,</t> CD25, IKZF2, IKZF4, CTLA4, TNFR2, CD62L, CD45 and IL2 (p value < 0.05: *; p value < 0.01: **; p value < 0.001: ***). Red bars represent statistically significant change in methylation. ( b ) The left heatmap shows average difference in beta values for individual Illumina CG Identifiers (CGs) of the Treg signature genes at yearly intervals. Increased blue coloration in the heat map means increased demethylation of the CpG sites within a Treg signature gene. The right heatmap indicates the p-values in the corresponding CpG sites; Blank and red indicate without or with significance, respectively, and degree of red color reflects the strength of significance. In the both heatmaps each individual CpG gene site is represented as a single bar.
    Foxp3 Gene, supplied by EpigenDx, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/Human+FOXP3+Gene+Methylation+Pyrosequencing+Assays/pmc08298580-302-19-34
    Average 93 stars, based on 1 article reviews
    foxp3 gene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    EpigenDx methylation pyrosequencing assay
    Most Treg signature genes gradually demethylate over a three year time course after in vivo BCG vaccinations. Methylation changes in eleven well-known Treg signature genes were quantified yearly after multi-dose BCG vaccine therapy (n = 13 type 1 diabetic subjects). ( a ) The methylation values are current methylation values at year 1, year 2 or year 3 compared to baseline expressed as average change in beta values. Positive beta values indicate increased methylation and thus decreased gene expression; negative methylation values indicate demethylation and increased gene expression. Significant decreases in methylation after BCG were seen in eight of 11 genes: <t>FOXP3,</t> CD25, IKZF2, IKZF4, CTLA4, TNFR2, CD62L, CD45 and IL2 (p value < 0.05: *; p value < 0.01: **; p value < 0.001: ***). Red bars represent statistically significant change in methylation. ( b ) The left heatmap shows average difference in beta values for individual Illumina CG Identifiers (CGs) of the Treg signature genes at yearly intervals. Increased blue coloration in the heat map means increased demethylation of the CpG sites within a Treg signature gene. The right heatmap indicates the p-values in the corresponding CpG sites; Blank and red indicate without or with significance, respectively, and degree of red color reflects the strength of significance. In the both heatmaps each individual CpG gene site is represented as a single bar.
    Methylation Pyrosequencing Assay, supplied by EpigenDx, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+foxp3+gene/Human+FOXP3+Gene+Methylation+Pyrosequencing+Assays/pmc06883627__13148_2019_771_MOESM1_ESM-0-6-72
    Average 93 stars, based on 1 article reviews
    methylation pyrosequencing assay - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    A. Foxp3 expression is examined with western blotting assay in three T24 bladder cancer sublines (T24-P, T24-L, and T24-B). B. Assays for glucose, lactate, and ATP production in three T24 sublines. C. VEGF mRNA and D. GLUT-1~5 mRNA expression is examined in three T24 sublines using qRT-PCR assay. E. Foxp3 mRNA expression is examined in Foxp3-knocking down T24-B transfectants and its control. F. Assays for glucose and lactate production, G. VEGF mRNA expression, and H. GLUT-1~5 as assayed in Foxp3-knocking down transfectant #25 and its control. I. Foxp3 expression is examined with western blotting assay after transient transfection of Foxp3 plasmid into T24-P bladder cancer cells. J. Assays for glucose and lactate production, K. VEGF mRNA expression, and L. GLUT-1~5 as assayed in pooled Foxp3-overexpressing T24-P transfectants and its control. T24-P, T24 parental subline; T24-L, metastatic lung T24 subline; T24-B, metastatic bone T24 subline; ATP, Adenosine triphosphate; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; VEGF, vascular endothelial growth factor; NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: A. Foxp3 expression is examined with western blotting assay in three T24 bladder cancer sublines (T24-P, T24-L, and T24-B). B. Assays for glucose, lactate, and ATP production in three T24 sublines. C. VEGF mRNA and D. GLUT-1~5 mRNA expression is examined in three T24 sublines using qRT-PCR assay. E. Foxp3 mRNA expression is examined in Foxp3-knocking down T24-B transfectants and its control. F. Assays for glucose and lactate production, G. VEGF mRNA expression, and H. GLUT-1~5 as assayed in Foxp3-knocking down transfectant #25 and its control. I. Foxp3 expression is examined with western blotting assay after transient transfection of Foxp3 plasmid into T24-P bladder cancer cells. J. Assays for glucose and lactate production, K. VEGF mRNA expression, and L. GLUT-1~5 as assayed in pooled Foxp3-overexpressing T24-P transfectants and its control. T24-P, T24 parental subline; T24-L, metastatic lung T24 subline; T24-B, metastatic bone T24 subline; ATP, Adenosine triphosphate; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; VEGF, vascular endothelial growth factor; NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Expressing, Western Blot, Quantitative RT-PCR, Transfection, Plasmid Preparation

    A. T24-B cell were stained with anti-Foxp3, anti-HIF-1α and DAPI for confocal microscopy studies in normoxic and hypoxic circumstance as indicated times. Scale bars, 10 μm. B. T24-B cell were maintained in normoxic and hypoxic circumstance as indicated times. Cell lysates were immunoprecipitated with anti-Foxp3 antibody and subjected to Foxp3 and HIF-1α western blot.

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: A. T24-B cell were stained with anti-Foxp3, anti-HIF-1α and DAPI for confocal microscopy studies in normoxic and hypoxic circumstance as indicated times. Scale bars, 10 μm. B. T24-B cell were maintained in normoxic and hypoxic circumstance as indicated times. Cell lysates were immunoprecipitated with anti-Foxp3 antibody and subjected to Foxp3 and HIF-1α western blot.

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Staining, Confocal Microscopy, Immunoprecipitation, Western Blot

    A. HIF-1α mRNA expression were examined in T24-B Foxp3 knocking down cells and its control both in normoxic and hypoxic circumstances using qRT-PCR assays. B. Foxp3-knocking down T24B cells and its control were maintained in normoxic and hypoxic circumstance and cell lysates for harvested for western blot. C. After transfection, cells were maintained in normoxic and hypoxic circumstance and treated with MG132 (10μM) for 24 hours before harvesting for western blotting assay. D. Foxp3 and HIF-1α mRNA expression were examined in Foxp3-overexpressing T24-P cells and its control in normoxic circumstance using qRT-PCR assays. E. T24-P cells were transfected with Foxp3 cDNA-containing plasmids or control as indicated conditions with or without MG132 treatment. Cell lysates were immunoprecipitated with anti-Foxp3 or anti-ubiquitin antibody and subjected to Foxp3, HIF-1α or ubiquitin western blot. F. In vivo ubiquitination assay. T24-P cells were transfected with Foxp3 cDNA-carrying plasmid in a dose-dependent manner, as well as histdine-tagged ubiquitin cDNA. Cell lysates were harvested and Histiidine-containing protein complex were pulled down using Ni ++ -NTA magnetic bead for subquentent immunoblotting assay. The expression of β-actin used as a loading control. NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: A. HIF-1α mRNA expression were examined in T24-B Foxp3 knocking down cells and its control both in normoxic and hypoxic circumstances using qRT-PCR assays. B. Foxp3-knocking down T24B cells and its control were maintained in normoxic and hypoxic circumstance and cell lysates for harvested for western blot. C. After transfection, cells were maintained in normoxic and hypoxic circumstance and treated with MG132 (10μM) for 24 hours before harvesting for western blotting assay. D. Foxp3 and HIF-1α mRNA expression were examined in Foxp3-overexpressing T24-P cells and its control in normoxic circumstance using qRT-PCR assays. E. T24-P cells were transfected with Foxp3 cDNA-containing plasmids or control as indicated conditions with or without MG132 treatment. Cell lysates were immunoprecipitated with anti-Foxp3 or anti-ubiquitin antibody and subjected to Foxp3, HIF-1α or ubiquitin western blot. F. In vivo ubiquitination assay. T24-P cells were transfected with Foxp3 cDNA-carrying plasmid in a dose-dependent manner, as well as histdine-tagged ubiquitin cDNA. Cell lysates were harvested and Histiidine-containing protein complex were pulled down using Ni ++ -NTA magnetic bead for subquentent immunoblotting assay. The expression of β-actin used as a loading control. NS, not significant; *, p<0.05; **, p<0.01, ***, p<0.001. Data are represented as mean ± SD.

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Expressing, Quantitative RT-PCR, Western Blot, Transfection, Immunoprecipitation, In Vivo, Ubiquitin Assay, Plasmid Preparation

    Female NOD-SCID mice were subcutaneously injected with 1×10 6 Foxp3 knocking-down T24-B in 100 ml serum-free medium or its control. In vivo growth A. and survival curve B. were record and analyzed. C. The growing tumor were harvested at day 58 for immunostaining of von Willebrand factor , Magnification × 200. Scale bars, 50 μ. D. The integrated density were calculated using Imaging-Pro Plus software and compared with unpaired t -test.

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: Female NOD-SCID mice were subcutaneously injected with 1×10 6 Foxp3 knocking-down T24-B in 100 ml serum-free medium or its control. In vivo growth A. and survival curve B. were record and analyzed. C. The growing tumor were harvested at day 58 for immunostaining of von Willebrand factor , Magnification × 200. Scale bars, 50 μ. D. The integrated density were calculated using Imaging-Pro Plus software and compared with unpaired t -test.

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Injection, In Vivo, Immunostaining, Imaging, Software

    A. Negative Foxp3 expression (× 200; scale bar, 50 μm), B. Positive Foxp3 expression (× 200; scale bar, 50 μm), C. Foxp3+ lymphocytes within the bladder tumor (× 400; scale bar, 50 μm). D. More than 8 CD8+ lymphocyte within bladder tumors, E. 1≤ CD8+ lymphocyte number ≤8, and F. none of CD8+ lymphocytes based on the average number determined from 10 random 0.0328-mm 2 digital images captured under high power field (× 320; scale bar, 20 μm). G. Distribution and mean number of CD8+TILs from 96 bladder cancer specimen according to Foxp3 expression. H. The comparison of average CD8+ TILs number between Foxp3-expressing tumors or not is analyzed using unpaired t -test. Foxp3-expressing lymphocytes (arrow).

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: A. Negative Foxp3 expression (× 200; scale bar, 50 μm), B. Positive Foxp3 expression (× 200; scale bar, 50 μm), C. Foxp3+ lymphocytes within the bladder tumor (× 400; scale bar, 50 μm). D. More than 8 CD8+ lymphocyte within bladder tumors, E. 1≤ CD8+ lymphocyte number ≤8, and F. none of CD8+ lymphocytes based on the average number determined from 10 random 0.0328-mm 2 digital images captured under high power field (× 320; scale bar, 20 μm). G. Distribution and mean number of CD8+TILs from 96 bladder cancer specimen according to Foxp3 expression. H. The comparison of average CD8+ TILs number between Foxp3-expressing tumors or not is analyzed using unpaired t -test. Foxp3-expressing lymphocytes (arrow).

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Expressing

    Clinicopathological correlate of  Foxp3  expression in superficial bladder carcinoma tissues

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: Clinicopathological correlate of Foxp3 expression in superficial bladder carcinoma tissues

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Expressing

    A. Proportion of recurrence-free survival according to the Foxp3 expression. B. Proportion of progression-free survival according to the Foxp3 expression. RFS, recurrence-free survival; PFS, progression-free survival.

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: A. Proportion of recurrence-free survival according to the Foxp3 expression. B. Proportion of progression-free survival according to the Foxp3 expression. RFS, recurrence-free survival; PFS, progression-free survival.

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Expressing

    Univariate and multivariate analyses of variables associated with recurrence and progression in 115 superficial bladder cancer patients

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: Univariate and multivariate analyses of variables associated with recurrence and progression in 115 superficial bladder cancer patients

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Expressing

    Correlation of  Foxp3  expression with the Glucose transporter family member: result of a meta-analysis of GSE32548 (n=131) and GSE48075 (n=142)

    Journal: Oncotarget

    Article Title: Foxp3 enhances HIF-1α target gene expression in human bladder cancer through decreasing its ubiquitin-proteasomal degradation

    doi: 10.18632/oncotarget.11395

    Figure Lengend Snippet: Correlation of Foxp3 expression with the Glucose transporter family member: result of a meta-analysis of GSE32548 (n=131) and GSE48075 (n=142)

    Article Snippet: The plasmid pCMV3-N-HA-Foxp3 was purchased from Sino Biological Inc. (catalog number: HG11652-NY, Beijing, China).

    Techniques: Expressing

    Most Treg signature genes gradually demethylate over a three year time course after in vivo BCG vaccinations. Methylation changes in eleven well-known Treg signature genes were quantified yearly after multi-dose BCG vaccine therapy (n = 13 type 1 diabetic subjects). ( a ) The methylation values are current methylation values at year 1, year 2 or year 3 compared to baseline expressed as average change in beta values. Positive beta values indicate increased methylation and thus decreased gene expression; negative methylation values indicate demethylation and increased gene expression. Significant decreases in methylation after BCG were seen in eight of 11 genes: FOXP3, CD25, IKZF2, IKZF4, CTLA4, TNFR2, CD62L, CD45 and IL2 (p value < 0.05: *; p value < 0.01: **; p value < 0.001: ***). Red bars represent statistically significant change in methylation. ( b ) The left heatmap shows average difference in beta values for individual Illumina CG Identifiers (CGs) of the Treg signature genes at yearly intervals. Increased blue coloration in the heat map means increased demethylation of the CpG sites within a Treg signature gene. The right heatmap indicates the p-values in the corresponding CpG sites; Blank and red indicate without or with significance, respectively, and degree of red color reflects the strength of significance. In the both heatmaps each individual CpG gene site is represented as a single bar.

    Journal: Scientific Reports

    Article Title: BCG therapy is associated with long-term, durable induction of Treg signature genes by epigenetic modulation

    doi: 10.1038/s41598-021-94529-2

    Figure Lengend Snippet: Most Treg signature genes gradually demethylate over a three year time course after in vivo BCG vaccinations. Methylation changes in eleven well-known Treg signature genes were quantified yearly after multi-dose BCG vaccine therapy (n = 13 type 1 diabetic subjects). ( a ) The methylation values are current methylation values at year 1, year 2 or year 3 compared to baseline expressed as average change in beta values. Positive beta values indicate increased methylation and thus decreased gene expression; negative methylation values indicate demethylation and increased gene expression. Significant decreases in methylation after BCG were seen in eight of 11 genes: FOXP3, CD25, IKZF2, IKZF4, CTLA4, TNFR2, CD62L, CD45 and IL2 (p value < 0.05: *; p value < 0.01: **; p value < 0.001: ***). Red bars represent statistically significant change in methylation. ( b ) The left heatmap shows average difference in beta values for individual Illumina CG Identifiers (CGs) of the Treg signature genes at yearly intervals. Increased blue coloration in the heat map means increased demethylation of the CpG sites within a Treg signature gene. The right heatmap indicates the p-values in the corresponding CpG sites; Blank and red indicate without or with significance, respectively, and degree of red color reflects the strength of significance. In the both heatmaps each individual CpG gene site is represented as a single bar.

    Article Snippet: Since the Human Infinium Methylation Epic Bead Chip did not contain the DNA for the TSDR region of the Foxp3 gene, both pyrosequencing and NGBS methods were used to assess methylation of this region (EpigenDx, Hopkinton, MA).

    Techniques: In Vivo, Methylation, Expressing

    Baseline over methylation of the Foxp3 gene of Treg cells compared to controls; BCG therapy gradually restores towards normal methylation patterns over three years. ( a ) At baseline, prior to BCG treatment, type 1 diabetic subjects (n = 13) have over methylation of the Foxp3 Treg gene compared to non-diabetic control subjects (n = 8) suggesting inadequate Treg mediated suppression, a trait of autoimmunity (p = 0.03). At three year follow-up after multi-dosing with BCG therapy, the type 1 diabetic subjects’ over methylation defect in the Foxp3 gene corrects towards normal and is no longer statistically different from the degree of methylation in non-diabetic control cells (p = 0.39). Data is expressed as beta values of the difference between diabetic and control methylation. The data for each CpG is color coded separately (p value < 0.05: *; p value < 0.01: **; p value < 0.001: ***). Red bars represent statistically significant change in methylation. ( b ) Methylation changes for the individual CpG sites of Foxp3 gene after BCG were quantified compared to self at baseline. Average yearly changes in Beta Values of Foxp3 CpG sites in CD4 + cells of patients given BCG (n = 13). Beta value differences were calculated for each patient relative to baseline. ( c ) The left heatmap shows average difference in beta values for individual Foxp3 CpGs sites at yearly intervals. Increased blue coloration in the heatmap means increased demethylation of the CpG sites within the Foxp3 gene. The right heatmap indicates the p-values in the corresponding CpG sites; Blank and red indicate without or with significance, respectively, and degree of red color reflects the strength of significance.

    Journal: Scientific Reports

    Article Title: BCG therapy is associated with long-term, durable induction of Treg signature genes by epigenetic modulation

    doi: 10.1038/s41598-021-94529-2

    Figure Lengend Snippet: Baseline over methylation of the Foxp3 gene of Treg cells compared to controls; BCG therapy gradually restores towards normal methylation patterns over three years. ( a ) At baseline, prior to BCG treatment, type 1 diabetic subjects (n = 13) have over methylation of the Foxp3 Treg gene compared to non-diabetic control subjects (n = 8) suggesting inadequate Treg mediated suppression, a trait of autoimmunity (p = 0.03). At three year follow-up after multi-dosing with BCG therapy, the type 1 diabetic subjects’ over methylation defect in the Foxp3 gene corrects towards normal and is no longer statistically different from the degree of methylation in non-diabetic control cells (p = 0.39). Data is expressed as beta values of the difference between diabetic and control methylation. The data for each CpG is color coded separately (p value < 0.05: *; p value < 0.01: **; p value < 0.001: ***). Red bars represent statistically significant change in methylation. ( b ) Methylation changes for the individual CpG sites of Foxp3 gene after BCG were quantified compared to self at baseline. Average yearly changes in Beta Values of Foxp3 CpG sites in CD4 + cells of patients given BCG (n = 13). Beta value differences were calculated for each patient relative to baseline. ( c ) The left heatmap shows average difference in beta values for individual Foxp3 CpGs sites at yearly intervals. Increased blue coloration in the heatmap means increased demethylation of the CpG sites within the Foxp3 gene. The right heatmap indicates the p-values in the corresponding CpG sites; Blank and red indicate without or with significance, respectively, and degree of red color reflects the strength of significance.

    Article Snippet: Since the Human Infinium Methylation Epic Bead Chip did not contain the DNA for the TSDR region of the Foxp3 gene, both pyrosequencing and NGBS methods were used to assess methylation of this region (EpigenDx, Hopkinton, MA).

    Techniques: Methylation

    Younger Age of onset of diabetic subjects appear to show a different rates of demethylation at the CpG sites of Foxp3 gene. Type 1 diabetic subjects with a young age of onset (AOO) are considered to have a more serious and aggressive disease with rapid destruction of the pancreatic insulin secreting cells often defined as AOO < 20 years ( a , left column, n = 5). Type 1 diabetic subjects with an older age of onset (AOO > 20) years are considered to have a more indolent disease with onset at older ages ( b , right column, n = 8). This in the clinic correlates with a faster lowering of blood sugars after BCG therapy . Both groups of type 1 diabetics with varying ages of onset had a BCG response as related to Foxp3 demethylation, but early AOO type diabetics (AOO < 20) had an apparent faster responding trend over the 3 year monitoring time period. c . Average change in beta value of Foxp3-related CpG sites are shown at AOO < 20 and 20 <. At year 1, the demethylation patterns were statistically different between early and late onset with early onset diabetic subjects showing faster demethylation (p = 0.009). At year 2 the demethylation patters were again statistically different with the early onset diabetic subjects showing faster Foxp3 gene demethylation (p = 0.0005) but by year 3 both clinical subjects with type 1 diabetics but varying is the disease onset had achieved equal demethylation of the Foxp3 gene (p = 0.64). Right column indicates the difference in beta value between AOO < 20 and 20 <. Red bars represent statistically significant changes in methylation vs baseline for individual CpGs.

    Journal: Scientific Reports

    Article Title: BCG therapy is associated with long-term, durable induction of Treg signature genes by epigenetic modulation

    doi: 10.1038/s41598-021-94529-2

    Figure Lengend Snippet: Younger Age of onset of diabetic subjects appear to show a different rates of demethylation at the CpG sites of Foxp3 gene. Type 1 diabetic subjects with a young age of onset (AOO) are considered to have a more serious and aggressive disease with rapid destruction of the pancreatic insulin secreting cells often defined as AOO < 20 years ( a , left column, n = 5). Type 1 diabetic subjects with an older age of onset (AOO > 20) years are considered to have a more indolent disease with onset at older ages ( b , right column, n = 8). This in the clinic correlates with a faster lowering of blood sugars after BCG therapy . Both groups of type 1 diabetics with varying ages of onset had a BCG response as related to Foxp3 demethylation, but early AOO type diabetics (AOO < 20) had an apparent faster responding trend over the 3 year monitoring time period. c . Average change in beta value of Foxp3-related CpG sites are shown at AOO < 20 and 20 <. At year 1, the demethylation patterns were statistically different between early and late onset with early onset diabetic subjects showing faster demethylation (p = 0.009). At year 2 the demethylation patters were again statistically different with the early onset diabetic subjects showing faster Foxp3 gene demethylation (p = 0.0005) but by year 3 both clinical subjects with type 1 diabetics but varying is the disease onset had achieved equal demethylation of the Foxp3 gene (p = 0.64). Right column indicates the difference in beta value between AOO < 20 and 20 <. Red bars represent statistically significant changes in methylation vs baseline for individual CpGs.

    Article Snippet: Since the Human Infinium Methylation Epic Bead Chip did not contain the DNA for the TSDR region of the Foxp3 gene, both pyrosequencing and NGBS methods were used to assess methylation of this region (EpigenDx, Hopkinton, MA).

    Techniques: Methylation

    The change in mRNA expression and Treg population by BCG vaccination; direct data on the TSDR region of the Foxp3 gene and quantification of Foxp3 Treg cells. ( a ) The change in transcripts in CD4 + T cell by BCG was evaluated with mRNA seq. While no prominent changes were shown at year 1, most of Treg genes including FOXP3, TNFRSF18, CD25, IKZF4, CTLA4, FAS and CD45 were significantly upregulated at year 2 and year 3. Meanwhile, IKZF2, CD62L and IL2 showed upregulated mRNA expressions without significant. ( b ) The left heatmap indicate overall change in mRNA expression after BCG vaccination in each Treg gene. Red and green indicate up- and down-regulation in mRNA, respectively. ( c ) The average change in methylation (%) in Treg specific demethylated region (TSDR) was shown at baseline, 8 and 58 weeks after BCG vaccination (T1D, n = 4). While the ratio was 83.3 ± 5.5% at baseline, 80.8 ± 3.4% at 8 weeks and 65.5 ± 14.4% at 58 weeks (at 58 weeks, vs. baseline, p = 0.052; vs. 8 weeks, p = 0.08; one-tailed, paired t-test). ( d ) The representative gating images in flow cytometry are shown. Images of unstained, from one patient at baseline and 58 weeks after BCG vaccination are displayed in right, middle and right, respectively. ( e ) The percentage of Treg population was analyzed by flowcytometry. The individual data points for Treg frequency pre- and post-therapy were shown (n = 4). While the average ratio was 4.4 ± 1.1% at baseline, it was 6.3 ± 1.4% at 58 weeks (p = 0.01, two-tailed, paired t-test).

    Journal: Scientific Reports

    Article Title: BCG therapy is associated with long-term, durable induction of Treg signature genes by epigenetic modulation

    doi: 10.1038/s41598-021-94529-2

    Figure Lengend Snippet: The change in mRNA expression and Treg population by BCG vaccination; direct data on the TSDR region of the Foxp3 gene and quantification of Foxp3 Treg cells. ( a ) The change in transcripts in CD4 + T cell by BCG was evaluated with mRNA seq. While no prominent changes were shown at year 1, most of Treg genes including FOXP3, TNFRSF18, CD25, IKZF4, CTLA4, FAS and CD45 were significantly upregulated at year 2 and year 3. Meanwhile, IKZF2, CD62L and IL2 showed upregulated mRNA expressions without significant. ( b ) The left heatmap indicate overall change in mRNA expression after BCG vaccination in each Treg gene. Red and green indicate up- and down-regulation in mRNA, respectively. ( c ) The average change in methylation (%) in Treg specific demethylated region (TSDR) was shown at baseline, 8 and 58 weeks after BCG vaccination (T1D, n = 4). While the ratio was 83.3 ± 5.5% at baseline, 80.8 ± 3.4% at 8 weeks and 65.5 ± 14.4% at 58 weeks (at 58 weeks, vs. baseline, p = 0.052; vs. 8 weeks, p = 0.08; one-tailed, paired t-test). ( d ) The representative gating images in flow cytometry are shown. Images of unstained, from one patient at baseline and 58 weeks after BCG vaccination are displayed in right, middle and right, respectively. ( e ) The percentage of Treg population was analyzed by flowcytometry. The individual data points for Treg frequency pre- and post-therapy were shown (n = 4). While the average ratio was 4.4 ± 1.1% at baseline, it was 6.3 ± 1.4% at 58 weeks (p = 0.01, two-tailed, paired t-test).

    Article Snippet: Since the Human Infinium Methylation Epic Bead Chip did not contain the DNA for the TSDR region of the Foxp3 gene, both pyrosequencing and NGBS methods were used to assess methylation of this region (EpigenDx, Hopkinton, MA).

    Techniques: Expressing, Methylation, One-tailed Test, Flow Cytometry, Two Tailed Test